Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

His6-SUMO-pET28a-EfaCas1
(Plasmid #112793)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112793 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    His6-SUMO-pET28a
  • Backbone size w/o insert (bp) 5800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EfaCas1
  • Species
    Synthetic
  • Tag / Fusion Protein
    • His6-SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site cgcGGATCCATGGGCTGGCGAACGGTAGTGG (destroyed during cloning)
  • 3′ cloning site AAGGAAAAAAGCGGCCGCTCATATCCCAAACTCTGGAACT (destroyed during cloning)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His6-SUMO-pET28a-EfaCas1 was a gift from Ailong Ke (Addgene plasmid # 112793 ; http://n2t.net/addgene:112793 ; RRID:Addgene_112793)
  • For your References section:

    How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Xiao Y, Ng S, Nam KH, Ke A. Nature. 2017 Oct 5;550(7674):137-141. doi: 10.1038/nature24020. Epub 2017 Sep 4. 10.1038/nature24020 PubMed 28869593