Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-2T-GST-eIF4E K119A
(Plasmid #112818)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112818 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4948
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow in BL21(DE3) cells for protein overexpression
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Eif4e
  • Alt name
    Eukaryotic translation initiation factor 4E
  • Alt name
    mRNA cap-binding protein
  • Species
    M. musculus (mouse)
  • Mutation
    K119 mutated to A, increasing affinity for cap structure (Spivak-Kroizman et al. 2002)
  • Entrez Gene
    Eif4e (a.k.a. EG668879, Eif4e-ps, If4e, eIF-4E)
  • Promoter T7
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pGEX-F (CCCATCCTGACTTCATGTTGTATGACGC)
  • 3′ sequencing primer pGEX-R (CGCTACGTGACTGGGTCATGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Modified from pGEX-2T-GST-eIF4E provided by Jerry Pelletier, McGill University
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-2T-GST-eIF4E K119A was a gift from Daniel Schoenberg (Addgene plasmid # 112818 ; http://n2t.net/addgene:112818 ; RRID:Addgene_112818)
  • For your References section:

    RNA guanine-7 methyltransferase catalyzes the methylation of cytoplasmically recapped RNAs. Trotman JB, Giltmier AJ, Mukherjee C, Schoenberg DR. Nucleic Acids Res. 2017 Oct 13;45(18):10726-10739. doi: 10.1093/nar/gkx801. 10.1093/nar/gkx801 PubMed 28981715