Skip to main content

EasyFusion Halo
(Plasmid #112850)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112850 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript SK (-)
  • Backbone size w/o insert (bp) 2642
  • Total vector size (bp) 3886
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag
  • Species
    Synthetic
  • Promoter No

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACACAGGAAACAGCTATGAC
  • 3′ sequencing primer CGCAACTGTTGGGAAGGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EasyFusion Halo was a gift from Janet Rossant (Addgene plasmid # 112850 ; http://n2t.net/addgene:112850 ; RRID:Addgene_112850)
  • For your References section:

    Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212