Skip to main content

pEYFP-N3-EPAC1
(Plasmid #113110)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113110 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 113110-D50 50 μg of DNA in Tris buffer $495
DNA 113110-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 7500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; GFP expressiom

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RapGEF3
  • Alt name
    EPAC1
  • Alt name
    cAMP-GEF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2743
  • GenBank ID
    NM_006105.5
  • Entrez Gene
    RAPGEF3 (a.k.a. CAMP-GEFI, EPAC, EPAC1, HSU79275, bcm910)
  • Promoter PCMV
  • Tag / Fusion Protein
    • EYFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer GFP N-terminal sequence
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    J. L. Bos (University Medical Center Utrecht, The Netherlands)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEYFP-N3-EPAC1 was a gift from Xiaodong Cheng (Addgene plasmid # 113110 ; http://n2t.net/addgene:113110 ; RRID:Addgene_113110)
  • For your References section:

    Differential signaling of cyclic AMP: opposing effects of exchange protein directly activated by cyclic AMP and cAMP-dependent protein kinase on protein kinase B activation. Mei FC, Qiao J, Tsygankova OM, Meinkoth JL, Quilliam LA, Cheng X. J Biol Chem. 2002 Mar 29;277(13):11497-504. doi: 10.1074/jbc.M110856200. Epub 2002 Jan 18. 10.1074/jbc.M110856200 PubMed 11801596