pEYFP-N3-EPAC1
(Plasmid #113110)

• Purpose: Human EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).
• Depositing Lab: Xiaodong Cheng
• Publication: Mei et al J Biol Chem. 2002 Mar 29;277(13):11497-504. doi: 10.1074/jbc.M110856200. Epub 2002 Jan 18.

Backbone

• Vector backbone: pEGFP-N3
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 7500
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; GFP expressiom

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RapGEF3
• Alt name: EPAC1
• Alt name: cAMP-GEF1
• Species: H. sapiens (human)
• Insert Size (bp): 2743
• GenBank ID: NM_006105.5
• Entrez Gene: RAPGEF3 (a.k.a. CAMP-GEFI, EPAC, EPAC1, HSU79275, bcm910)
• Promoter: PCMV
• Tag / Fusion Protein:
  • EYFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: GFP N-terminal sequence

Resource Information

• A portion of this plasmid was derived from a plasmid made by: J. L. Bos (University Medical Center Utrecht, The Netherlands)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry