pCD175
(Plasmid
#113316)
-
PurposedCas9, MCP-AsiA, rpoD_F563Y
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A vector
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9, MCP-T4.AsiA, rpoD_F563Y
-
MutationF563Y
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACGCATTGATTTGAGTCAGC
- 3′ sequencing primer tcgtaagccatttccgctcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCD175 was a gift from Jesse Zalatan (Addgene plasmid # 113316 ; http://n2t.net/addgene:113316 ; RRID:Addgene_113316) -
For your References section:
Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria. Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG. Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6. 10.1038/s41467-018-04901-6 PubMed 29950558