-
PurposeExpresses 10xHis-MBP fused to LbCas12a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
| Cloning Grade DNA | 113431-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $110 | |
Backbone
-
Vector backbonepMBP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLbCas12a
-
Insert Size (bp)3684
- Promoter T7
-
Tag
/ Fusion Protein
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer CTA GTT ATT GCT CAG CGG T
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Cloning Grade DNA (Catalog # 113431-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $110 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMBP-LbCas12a was a gift from Jennifer Doudna (Addgene plasmid # 113431 ; http://n2t.net/addgene:113431 ; RRID:Addgene_113431) -
For your References section:
CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA. Science. 2018 Apr 27;360(6387):436-439. doi: 10.1126/science.aar6245. Epub 2018 Feb 15. 10.1126/science.aar6245 PubMed 29449511