pLenti GW-mCit-PA
(Plasmid
#113457)
-
Purpose(Empty Backbone) Lentiviral ProteinA-mCitrine Gateway shuttle vector for C-terminal fusions
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerFUGW was a gift from David Baltimore (Addgene plasmid # 14883)
- Backbone size (bp) 9955
-
Vector typeMammalian Expression, Lentiviral
- Promoter hUbC
-
Tag
/ Fusion Protein
- mCitrine-ProteinA (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgaagctccggttttgaact
- 3′ sequencing primer agtgtgagtttcccatatgtcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byViral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti GW-mCit-PA was a gift from Erich Wanker (Addgene plasmid # 113457 ; http://n2t.net/addgene:113457 ; RRID:Addgene_113457) -
For your References section:
LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244