-
PurposeConstitutive expression of a single sgRNA and the fluorophore violet-excited GFP in immune cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLX_TRC931
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 5180
- Total vector size (bp) 7664
-
Modifications to backbone(1) Introduction of sgRNA cloning cassette (2) Removal of LacI-2A sequence (3) Replacement of GFP with Vex (4) Mutation of additional BsmBI cloning sites (outside sgRNA cloning cassette)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersVex fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNA
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA cloning site
-
gRNA/shRNA sequenceNA
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTGAATAGAGTTAGGCAGGGATATTCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_053 was a gift from Arlene Sharpe (Addgene plasmid # 113591 ; http://n2t.net/addgene:113591 ; RRID:Addgene_113591) -
For your References section:
A CRISPR-Cas9 delivery system for in vivo screening of genes in the immune system. LaFleur MW, Nguyen TH, Coxe MA, Yates KB, Trombley JD, Weiss SA, Brown FD, Gillis JE, Coxe DJ, Doench JG, Haining WN, Sharpe AH. Nat Commun. 2019 Apr 10;10(1):1668. doi: 10.1038/s41467-019-09656-2. 10.1038/s41467-019-09656-2 PubMed 30971695