Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid #113762)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113762 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2
  • Backbone manufacturer
    Scott Sternson
  • Total vector size (bp) 7172
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stabl2 or Stabl3, 30C or 37C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdNfsB(F124W)-mCherry
  • Alt name
    nfsb, eNTR
  • Species
    E. coli
  • Insert Size (bp)
    2115
  • Mutation
    F124W
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TTAAAGCAGCGTATCCACAT
  • 3′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Sternson Lab recommendations for propagation of AAV-FLEX plasmids: "These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed."

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113762 ; http://n2t.net/addgene:113762 ; RRID:Addgene_113762)
  • For your References section:

    Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097