pUDR217
(Plasmid #113872)

• Purpose: expression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectively
• Depositing Labs: Jean-Marc Daran, Jack Pronk
• Publication: Wijsman et al FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107.

Backbone

• Vector backbone: pROS16
• Backbone manufacturer: Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
• Backbone size w/o insert (bp): 5462
• Total vector size (bp): 5462
• Modifications to backbone: Replacement of CAN1 sgRNA target with MAL11 and MPH2,3 sgRNA targets
• Vector type: Yeast Expression, CRISPR
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA9-MPH2-3 sgRNA10-MAL11
• gRNA/shRNA sequence: AAAGTACAGTATAAAAGTGAG / TTTAGCATTAAGATATTACA
• Species: S. cerevisiae (budding yeast)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pROS16 backbone is described in "CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786"