pUDR217
(Plasmid
#113872)
-
Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectively
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepROS16
-
Backbone manufacturerMans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
- Backbone size w/o insert (bp) 5462
- Total vector size (bp) 5462
-
Modifications to backboneReplacement of CAN1 sgRNA target with MAL11 and MPH2,3 sgRNA targets
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA9-MPH2-3 sgRNA10-MAL11
-
gRNA/shRNA sequenceAAAGTACAGTATAAAAGTGAG / TTTAGCATTAAGATATTACA
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pROS16 backbone is described in "CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786"
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDR217 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113872 ; http://n2t.net/addgene:113872 ; RRID:Addgene_113872) -
For your References section:
A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096