pUDR220
(Plasmid #113873)

• Purpose: expression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectively
• Depositing Labs: Jean-Marc Daran, Jack Pronk
• Publication: Wijsman et al FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107.

Backbone

• Vector backbone: pROS14 (#107928)
• Backbone manufacturer: Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
• Backbone size w/o insert (bp): 6632
• Total vector size (bp): 6632
• Modifications to backbone: replacement of double CAN1 sgRNA target with HXT10 and HXT9,11,12 sgRNA targets
• Vector type: Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA8-HXT10 sgRNA7-HXT9-11-12
• gRNA/shRNA sequence: TTACTATCAACAATAACTAA /
• Species: S. cerevisiae (budding yeast)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry