pUDR220
(Plasmid
#113873)
-
Purposeexpression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectively
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepROS14 (#107928)
-
Backbone manufacturerMans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
- Backbone size w/o insert (bp) 6632
- Total vector size (bp) 6632
-
Modifications to backbonereplacement of double CAN1 sgRNA target with HXT10 and HXT9,11,12 sgRNA targets
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA8-HXT10 sgRNA7-HXT9-11-12
-
gRNA/shRNA sequenceTTACTATCAACAATAACTAA /
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDR220 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113873 ; http://n2t.net/addgene:113873 ; RRID:Addgene_113873) -
For your References section:
A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096