pAAV-hSyn-LMO3 (sbGLuc-VChR1-EYFP)
(Plasmid
#114099)
-
Purposefusion protein of Gaussia luciferase variant slow burn, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogenetics
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4604
- Total vector size (bp) 6952
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase, slow burn
-
Alt namesbGLuc
- Promoter hSyn
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVolvox Channelrhodopsin 1
-
Alt nameVChR1
Gene/Insert 3
-
Gene/Insert nameEnhanced Yellow Fluorescent Protein
-
Alt nameEYFP
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-LMO3 (sbGLuc-VChR1-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114099 ; http://n2t.net/addgene:114099 ; RRID:Addgene_114099) -
For your References section:
Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation. Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):E358-67. doi: 10.1073/pnas.1510899113. Epub 2016 Jan 5. 10.1073/pnas.1510899113 PubMed 26733686