Skip to main content

pCW-eGFP-SHLD2
(Plasmid #114119)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114119 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Addgene #15100
  • Backbone size w/o insert (bp) 7720
  • Total vector size (bp) 11155
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SHLD2
  • Alt name
    FAM35A
  • Alt name
    RINN2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3435
  • Entrez Gene
    SHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORFeome
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The SHLD2 short isoform cDNA was obtained from the ORFeome collection. The complete coding sequence of the long isoform of SHLD2 was generated by combining a synthesized fragment corresponding to the long isoform C-terminus using an internal KpnI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-eGFP-SHLD2 was a gift from Daniel Durocher (Addgene plasmid # 114119 ; http://n2t.net/addgene:114119 ; RRID:Addgene_114119)
  • For your References section:

    The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168