Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLenti.puro.MCV.ER.RAZ.2
(Plasmid #114382)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114382 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCMVPuroDEST
  • Backbone size w/o insert (bp) 9628
  • Total vector size (bp) 9475
  • Modifications to backbone
    The backbone vector was cut using Cla1 and EcoRV, and then the PCR amplified Insert was cloned into these sites.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCV NCCR and tumor T antigen regions
  • Alt name
    NCCR, ST, LT, truncLT
  • Species
    Merkel cell polyomavirus
  • Insert Size (bp)
    2181
  • GenBank ID
    HM011555.1 JX045709.1
  • Promoter MCV NCCR (viral own promoter)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer AAGAATAGTAGACATAATAG
  • 3′ sequencing primer GTGGATGTGGAATGTGTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid was cloned by Anjali Vijaykumar and Reety Arora

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti.puro.MCV.ER.RAZ.2 was a gift from Reety Arora & Sudhir Krishna (Addgene plasmid # 114382 ; http://n2t.net/addgene:114382 ; RRID:Addgene_114382)