pBEAST-pBen-sfGFP
(Plasmid
#114598)
-
Purpose"Output expression of sfGFP under the activation of BenR transcription factor for cell-free expression"
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBEST-OR2-OR1-Pr-UTR1-deGFP-T500
-
Modifications to backboneTwo 40bp spacers were added to the each end of the insert to facilitate Gibson assembly cloning into more complex constructs. Upstream and downstream terminators (B0014 and B0015, respectively) we also added, each flanked by two 40bp spacers. The OR2-OR1-Pr promoter and UTR were replaced by the BenR-activated PBen and its native RBS, and deGFP was replaced by sfGFP.
-
Vector typeSynthetic Biology ; Cell-Free Protein Synthesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter PBen
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCTGAGCTAACACCGTGC
- 3′ sequencing primer GGCACCTGTCCTACGAGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEAST-pBen-sfGFP was a gift from Jerome Bonnet (Addgene plasmid # 114598 ; http://n2t.net/addgene:114598 ; RRID:Addgene_114598) -
For your References section:
Plug-and-play metabolic transducers expand the chemical detection space of cell-free biosensors. Voyvodic PL, Pandi A, Koch M, Conejero I, Valjent E, Courtet P, Renard E, Faulon JL, Bonnet J. Nat Commun. 2019 Apr 12;10(1):1697. doi: 10.1038/s41467-019-09722-9. 10.1038/s41467-019-09722-9 PubMed 30979906