pTK473
(Plasmid
#114715)
-
PurposesgRNA for LGN's N-terminal locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330_Addgene#42230
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLGN sgRNA
-
gRNA/shRNA sequencecttataatatgactcgatgg
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK473 was a gift from Tomomi Kiyomitsu (Addgene plasmid # 114715 ; http://n2t.net/addgene:114715 ; RRID:Addgene_114715) -
For your References section:
Dynein-Dynactin-NuMA clusters generate cortical spindle-pulling forces as a multi-arm ensemble. Okumura M, Natsume T, Kanemaki MT, Kiyomitsu T. Elife. 2018 May 31;7. pii: 36559. doi: 10.7554/eLife.36559. 10.7554/eLife.36559 PubMed 29848445