Skip to main content

FUW-TetON-GFP
(Plasmid #115495)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115495 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUW TetON (AddGene plasmid etO-FUW-OSKM Plasmid #20321)
  • Backbone manufacturer
    Whitehead Institute
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 9102
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Alt name
    GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaaagtcgagctcggtaccc
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-TetON-GFP was a gift from Catherine Verfaillie (Addgene plasmid # 115495 ; http://n2t.net/addgene:115495 ; RRID:Addgene_115495)
  • For your References section:

    SOX10 Single Transcription Factor-Based Fast and Efficient Generation of Oligodendrocytes from Human Pluripotent Stem Cells. Garcia-Leon JA, Kumar M, Boon R, Chau D, One J, Wolfs E, Eggermont K, Berckmans P, Gunhanlar N, de Vrij F, Lendemeijer B, Pavie B, Corthout N, Kushner SA, Davila JC, Lambrichts I, Hu WS, Verfaillie CM. Stem Cell Reports. 2018 Feb 13;10(2):655-672. doi: 10.1016/j.stemcr.2017.12.014. Epub 2018 Jan 11. 10.1016/j.stemcr.2017.12.014 PubMed 29337119