-
PurposeLentiviral plasmid for tet-inducible expression of GFP (generated from plasmid #20321)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUW TetON (AddGene plasmid etO-FUW-OSKM Plasmid #20321)
-
Backbone manufacturerWhitehead Institute
- Backbone size w/o insert (bp) 8400
- Total vector size (bp) 9102
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaaagtcgagctcggtaccc
- 3′ sequencing primer N/A (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-TetON-GFP was a gift from Catherine Verfaillie (Addgene plasmid # 115495 ; http://n2t.net/addgene:115495 ; RRID:Addgene_115495) -
For your References section:
SOX10 Single Transcription Factor-Based Fast and Efficient Generation of Oligodendrocytes from Human Pluripotent Stem Cells. Garcia-Leon JA, Kumar M, Boon R, Chau D, One J, Wolfs E, Eggermont K, Berckmans P, Gunhanlar N, de Vrij F, Lendemeijer B, Pavie B, Corthout N, Kushner SA, Davila JC, Lambrichts I, Hu WS, Verfaillie CM. Stem Cell Reports. 2018 Feb 13;10(2):655-672. doi: 10.1016/j.stemcr.2017.12.014. Epub 2018 Jan 11. 10.1016/j.stemcr.2017.12.014 PubMed 29337119