PB-CAG-GFPd2
(Plasmid
#115665)
-
PurposePiggybac transposon plasmid for destabilized eGFP (GFPd2)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG-GFP
- Backbone size w/o insert (bp) 5551
- Total vector size (bp) 6466
-
Modifications to backboneInsertion of piggybac inverted terminal repeats and destabilization domain to eGFP
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFPd2
-
Alt nameDestabilized eGFP
-
SpeciesSynthetic
-
Insert Size (bp)843
- Promoter CAG
-
Tag
/ Fusion Protein
- Destabilization (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned GFPd2 from Addgene plasmid 14760 and PBCAG-GFP backbone from Addgene plasmid 40973
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Co-transfection with super piggybac transposase leads to stable integration in mammalian chromosomal DNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-CAG-GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665 ; http://n2t.net/addgene:115665 ; RRID:Addgene_115665) -
For your References section:
Reducible branched ester-amine quadpolymers (rBEAQs) co-delivering plasmid DNA and RNA oligonucleotides enable CRISPR/Cas9 genome editing. Rui Y, Wilson D, Sanders K, Green JJ. ACS Appl Mater Interfaces. 2019 Feb 22. doi: 10.1021/acsami.8b20206. 10.1021/acsami.8b20206 PubMed 30794383