-
PurposeExpresses SpdCas9-Vp64 fusion protein when packaged into AAV
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-Ef1a-FAS-EGFP-WPRE-pA
- Backbone size w/o insert (bp) 3899
- Total vector size (bp) 8855
-
Vector typeMammalian Expression, AAV
-
Selectable markersNONE
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVP64
-
SpeciesS.pyogenes
-
Insert Size (bp)4452
- Promoter CMV
-
Tags
/ Fusion Proteins
- dCas9-VP64 (C terminal on insert)
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATAACTTACGGTAAATGGCCCGC
- 3′ sequencing primer GCCATAGAGCCCACCGCATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid: 47107
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-SpdCas9-VP64 was a gift from Nadav Ahituv (Addgene plasmid # 115794 ; http://n2t.net/addgene:115794 ; RRID:Addgene_115794) -
For your References section:
CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Matharu N, Rattanasopha S, Tamura S, Maliskova L, Wang Y, Bernard A, Hardin A, Eckalbar WL, Vaisse C, Ahituv N. Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629. 10.1126/science.aau0629 PubMed 30545847