-
PurposeExpresses human MCM2 and human MCM7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 116949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-32 Ek/LIK
- Total vector size (bp) 10930
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman MCM7
-
Alt nameminichromosome maintenance 7
-
Alt nameCDC47
-
Alt nameDNA replication licensing factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2633
-
GenBank IDNP_005907.3 P33993.4
-
Entrez GeneMCM7 (a.k.a. CDC47, MCM2, P1.1-MCM3, P1CDC47, P85MCM, PNAS146, PPP1R104)
-
Tag
/ Fusion Protein
- Thioredoxin, His6
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gacgacgacaagatggcactgaaggactacgcgctag
- 3′ sequencing primer cgcgggcggccgtcagacaaaagtgatccgtgtccggg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman MCM2
-
Alt nameminichromosome maintenance 2
-
Alt nameDNA replication licensing factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2735
-
GenBank IDNP_004517.2
-
Entrez GeneMCM2 (a.k.a. BM28, CCNL1, CDCL1, D3S3194, DFNA70, MITOTIN, cdc19)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcgggcccggcctccatggcggaatcatcggaatccttcacc
- 3′ sequencing primer gaggagaagcccggtcagaactgctgcaggatcattttcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJuan Mendez CISC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET32-MCM2/7 was a gift from James Chong (Addgene plasmid # 116949 ; http://n2t.net/addgene:116949 ; RRID:Addgene_116949) -
For your References section:
DNA induces conformational changes in a recombinant human minichromosome maintenance complex. Hesketh EL, Parker-Manuel RP, Chaban Y, Satti R, Coverley D, Orlova EV, Chong JP. J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3. 10.1074/jbc.M114.622738 PubMed 25648893