Skip to main content

pRSF-MCM3/5
(Plasmid #116950)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 116950 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSFDuet-1 Ek/LIK
  • Total vector size (bp) 8379
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Human MCM5
  • Alt name
    minichromosome maintenance 5
  • Alt name
    DNA replication licensing factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2246
  • GenBank ID
    NP_006730.2
  • Entrez Gene
    MCM5 (a.k.a. CDC46, MGORS8, P1-CDC46)
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gacgacgacaagatgtcgggattcgacgatcctggc
  • 3′ sequencing primer cgcgggcggccgtcacttgaggcggtagagaaccttgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    human MCM3
  • Alt name
    minichromosome maintenance 3
  • Alt name
    DNA replication licensing factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2447
  • GenBank ID
    P25205.3
  • Entrez Gene
    MCM3 (a.k.a. HCC5, P1-MCM3, P1.h, RLFB)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gcgggcccggccttcatggcgggtaccgtggtgctggac
  • 3′ sequencing primer gaggagaagcccggtcagatgaggaagatgatgccctcag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Juan Mendez, CISC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation T194S in human MCM5 was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-MCM3/5 was a gift from James Chong (Addgene plasmid # 116950 ; http://n2t.net/addgene:116950 ; RRID:Addgene_116950)
  • For your References section:

    DNA induces conformational changes in a recombinant human minichromosome maintenance complex. Hesketh EL, Parker-Manuel RP, Chaban Y, Satti R, Coverley D, Orlova EV, Chong JP. J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3. 10.1074/jbc.M114.622738 PubMed 25648893