pJL1-mRFP1 gRNA
(Plasmid
#117052)
-
PurposeIn vitro expression of anti-mRFP1 Cas9 sgRNA from the T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJL1 (modified)
- Backbone size w/o insert (bp) 1631
- Total vector size (bp) 1777
-
Modifications to backbonedeleted ribosome binding site, spacer nucleotides between T7 promoter, insert, and terminator
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-mRFP1 SpCas9 gRNA
-
SpeciesSynthetic
-
Insert Size (bp)146
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcctggtatctttatagtc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-mRFP1 gRNA was a gift from Michael Jewett (Addgene plasmid # 117052 ; http://n2t.net/addgene:117052 ; RRID:Addgene_117052) -
For your References section:
BioBits Health: Classroom Activities Exploring Engineering, Biology, and Human Health with Fluorescent Readouts. Stark JC, Huang A, Hsu KJ, Dubner RS, Forbrook J, Marshalla S, Rodriguez F, Washington M, Rybnicky GA, Nguyen PQ, Hasselbacher B, Jabri R, Kamran R, Koralewski V, Wightkin W, Martinez T, Jewett MC. ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381. 10.1021/acssynbio.8b00381 PubMed 30925042