-
PurposeExpresses GFP-LC3-RFP in mammalian cells to measure autophagic flux without any drug resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5847
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemicrotubule-associated protein 1 light chain 3 beta
-
Alt nameMap1lc3b
-
Alt nameLC3
-
Alt nameLC3B
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2200
-
GenBank IDNM_022867.2
-
Entrez GeneMap1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- mRFP1 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene plasmid # 117413 ; http://n2t.net/addgene:117413 ; RRID:Addgene_117413) -
For your References section:
Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W, Nureki O, Mano H, Mizushima N. J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132. 10.1083/jcb.201804132 PubMed 30093494