-
PurposeThe plasmids pSpCas9 (BB)-2A-Puro (Addgene, #48139) and eSpCas9 (1.1) (Addgene, #71814) were combined to express both “enhanced specificity” Cas9 and puromycin resistance protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 9175
- Total vector size (bp) 9175
-
Modifications to backboneK (AAG) 848 A (GCC), K (AAG) 1003 A (GCG), R (CGG) 1060 A (GCG)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeSpCas9(1.1)
-
Alt nameK848A, K1003A, R1060A
-
SpeciesSynthetic
-
MutationK848A, K1003A, R1060A
- Promoter U6
-
Tag
/ Fusion Protein
- PuroR (R166H)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site BsmI (not destroyed)
- 5′ sequencing primer ACCCATTCCTGAAGGACAAC
- 3′ sequencing primer TGGCCAGGTACAGGAAGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Created by Yang LIU and Luc LEYNS ([email protected]) from the Vrije Universiteit Brussel (Belgium).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1)-Puro was a gift from Luc Leyns (Addgene plasmid # 117686 ; http://n2t.net/addgene:117686 ; RRID:Addgene_117686) -
For your References section:
Loss of Emp2 compromises cardiogenic differentiation in mouse embryonic stem cells. Liu Y, Dakou E, Meng Y, Leyns L. Biochem Biophys Res Commun. 2019 Feb 14. pii: S0006-291X(19)30235-9. doi: 10.1016/j.bbrc.2019.02.048. 10.1016/j.bbrc.2019.02.048 PubMed 30773261