Skip to main content

eSpCas9(1.1)-Puro
(Plasmid #117686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117686 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9175
  • Total vector size (bp) 9175
  • Modifications to backbone
    K (AAG) 848 A (GCC), K (AAG) 1003 A (GCG), R (CGG) 1060 A (GCG)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eSpCas9(1.1)
  • Alt name
    K848A, K1003A, R1060A
  • Species
    Synthetic
  • Mutation
    K848A, K1003A, R1060A
  • Promoter U6
  • Tag / Fusion Protein
    • PuroR (R166H)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site BsmI (not destroyed)
  • 5′ sequencing primer ACCCATTCCTGAAGGACAAC
  • 3′ sequencing primer TGGCCAGGTACAGGAAGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Created by Yang LIU and Luc LEYNS ([email protected]) from the Vrije Universiteit Brussel (Belgium).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)-Puro was a gift from Luc Leyns (Addgene plasmid # 117686 ; http://n2t.net/addgene:117686 ; RRID:Addgene_117686)
  • For your References section:

    Loss of Emp2 compromises cardiogenic differentiation in mouse embryonic stem cells. Liu Y, Dakou E, Meng Y, Leyns L. Biochem Biophys Res Commun. 2019 Feb 14. pii: S0006-291X(19)30235-9. doi: 10.1016/j.bbrc.2019.02.048. 10.1016/j.bbrc.2019.02.048 PubMed 30773261