Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pNBU2_erm-TetR-P1T_DP-GH023 - NanoLuc
(Plasmid #117728)


Item Catalog # Description Quantity Price (USD)
Plasmid 117728 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5907
  • Total vector size (bp) 6362
  • Vector type
    Bacterial Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    EC100D pir-116
  • Copy number


  • Gene/Insert name
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGCTTTCCAAGAGAAGAAAG
  • 3′ sequencing primer CACAATATGAGCAACAAGGAATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNBU2_erm-TetR-P1T_DP-GH023 - NanoLuc was a gift from Andrew Goodman (Addgene plasmid # 117728 ; ; RRID:Addgene_117728)
  • For your References section:

    Engineered Regulatory Systems Modulate Gene Expression of Human Commensals in the Gut. Lim B, Zimmermann M, Barry NA, Goodman AL. Cell. 2017 Apr 20;169(3):547-558.e15. doi: 10.1016/j.cell.2017.03.045. 10.1016/j.cell.2017.03.045 PubMed 28431252