Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
(Plasmid
#118155)
-
PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPRv2
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAB-dCas9-P2A-BlastR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4908
- Promoter hPGK and U6
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (not destroyed)
- 3′ cloning site Unknown (not destroyed)
- 3′ sequencing primer CTTGCTGGGCACCTTGTACT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We have also generated a version of this backbone with the core EF1a promoter driving the expression of KRAB-dCas9. We advise users to test both backbones in their cell type of interest. In our experience this backbone yields better knockdown in liver and pancreatic beta cells. Please visit https://www.biorxiv.org/content/early/2018/08/27/400291 for bioRxiv preprint.
We have also made available plasmids to be used as negative controls, which contain non-human genome target sequences (BFP or EGFP). Please see Addgene #118161, #118162, #118163 and #118164.
There is a third BsmBI site in the promoter region, which does not have an impact on the GoldenGate cloning. We recommend using the provided cloning protocol.
Note: Plasmid contains a N1396S mutation in dCas9. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR was a gift from Jorge Ferrer (Addgene plasmid # 118155 ; http://n2t.net/addgene:118155 ; RRID:Addgene_118155) -
For your References section:
Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. 10.1038/s41588-019-0457-0 PubMed 31253982