Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
(Plasmid #118155)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118155 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-P2A-BlastR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4908
  • Promoter hPGK and U6
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (not destroyed)
  • 3′ cloning site Unknown (not destroyed)
  • 3′ sequencing primer CTTGCTGGGCACCTTGTACT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

We have also generated a version of this backbone with the core EF1a promoter driving the expression of KRAB-dCas9. We advise users to test both backbones in their cell type of interest. In our experience this backbone yields better knockdown in liver and pancreatic beta cells. Please visit https://www.biorxiv.org/content/early/2018/08/27/400291 for bioRxiv preprint.

We have also made available plasmids to be used as negative controls, which contain non-human genome target sequences (BFP or EGFP). Please see Addgene #118161, #118162, #118163 and #118164.
There is a third BsmBI site in the promoter region, which does not have an impact on the GoldenGate cloning. We recommend using the provided cloning protocol.

Note: Plasmid contains a N1396S mutation in dCas9. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR was a gift from Jorge Ferrer (Addgene plasmid # 118155 ; http://n2t.net/addgene:118155 ; RRID:Addgene_118155)
  • For your References section:

    Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. 10.1038/s41588-019-0457-0 PubMed 31253982