-
Purposestable lentiviral expression of cDNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118391 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti-X1-hygro
-
Backbone manufacturerMichael Rape
- Backbone size w/o insert (bp) 9005
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAMP4
-
Alt nameSERP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)933
-
Entrez GeneSERP1
- Promoter EIF-1a promoter
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
- 3′ sequencing primer agcagcgtatccacatagcgt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' cloning site: BamHI (not destroyed), 3' cloning site: XbaI (not destroyed)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-X1-hygro-mCherry-RAMP4 was a gift from Jacob Corn (Addgene plasmid # 118391 ; http://n2t.net/addgene:118391 ; RRID:Addgene_118391) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524