pLEX307 GFP-Kif26b-C
(Plasmid
#118483)
-
Purposelentiviral expression of GFP-Kif26b-C in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118483 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_307
-
Backbone manufacturerAddgene #41392 (provided by David Root)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse Kif26b-C
-
Alt nameKif26b WRD domain (Wnt5a regulated degradation domain)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1140
-
MutationEncodes GFP fused to amino acid 1735 to 2112 of mouse Kif26b
-
GenBank IDNP_001155137.1
-
Entrez GeneKif26b (a.k.a. 4832420M10, BC056349, D230039L06Rik)
- Promoter EF1A
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX307 GFP-Kif26b-C was a gift from Henry Ho (Addgene plasmid # 118483 ; http://n2t.net/addgene:118483 ; RRID:Addgene_118483) -
For your References section:
Identification of a WNT5A-Responsive Degradation Domain in the Kinesin Superfamily Protein KIF26B. Karuna EP, Choi SS, Scales MK, Hum J, Cohen M, Fierro FA, Ho HH. Genes (Basel). 2018 Apr 5;9(4). pii: genes9040196. doi: 10.3390/genes9040196. 10.3390/genes9040196 PubMed 29621187