Skip to main content

pLKO.1-TetON-Puro-HIF1a 3809
(Plasmid #118705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118705 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-TetON-Puro
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA against human HIF1a
  • gRNA/shRNA sequence
    CCAGTTATGATTGTGAAGTTA
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-TetON-Puro-HIF1a 3809 was a gift from William Kaelin (Addgene plasmid # 118705 ; http://n2t.net/addgene:118705 ; RRID:Addgene_118705)
  • For your References section:

    Paracrine Induction of HIF by Glutamate in Breast Cancer: EglN1 Senses Cysteine. Briggs KJ, Koivunen P, Cao S, Backus KM, Olenchock BA, Patel H, Zhang Q, Signoretti S, Gerfen GJ, Richardson AL, Witkiewicz AK, Cravatt BF, Clardy J, Kaelin WG Jr. Cell. 2016 Jun 30;166(1):126-39. doi: 10.1016/j.cell.2016.05.042. 10.1016/j.cell.2016.05.042 PubMed 27368101