Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti CMV TRE3G Neo GFP-Lamin A wildtype
(Plasmid #118709)


Item Catalog # Description Quantity Price (USD)
Plasmid 118709 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pLenti CMV TRE3G Neomycin
  • Backbone manufacturer
    Eric Campeau
  • Backbone size w/o insert (bp) 8013
  • Total vector size (bp) 10795
  • Vector type
    Mammalian Expression, Lentiviral ; TET-ON inducible
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Construct may be grown in DH5A cells, and or 37 degrees, though STBL3 and 30 degrees are recommended to reduce chance of recombination events.
  • Copy number


  • Gene/Insert name
    GFP-Lamin A human wildtype
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
  • Promoter CMV TRE3G (TET-ON)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgaccagtttactccctatcagtg
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

To generate mammalian inducible cell lines co-infect with lentivirus made from:
pLenti CMV rtTA3 Hygro (w785-1)( Addgene Plasmid #26730)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV TRE3G Neo GFP-Lamin A wildtype was a gift from Tom Misteli (Addgene plasmid # 118709 ; ; RRID:Addgene_118709)