Skip to main content

MiniCoopR U6:gRNA p53, mitfa:Cas9
(Plasmid #118841)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118841 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MiniCoopR
  • Vector type
    CRISPR ; Tol2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tp53 gRNA
  • gRNA/shRNA sequence
    GGTGGGAGAGTGGATGGCTG
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    tp53 (a.k.a. brp53, drp53, etID22686.5, fb40d06, p53, wu:fb40d06, zgc:111919)

Cloning Information

  • Cloning method Gateway Cloning

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MiniCoopR U6:gRNA p53, mitfa:Cas9 was a gift from Leonard Zon (Addgene plasmid # 118841 ; http://n2t.net/addgene:118841 ; RRID:Addgene_118841)
  • For your References section:

    Human tumor genomics and zebrafish modeling identify SPRED1 loss as a driver of mucosal melanoma. Ablain J, Xu M, Rothschild H, Jordan RC, Mito JK, Daniels BH, Bell CF, Joseph NM, Wu H, Bastian BC, Zon LI, Yeh I. Science. 2018 Nov 1. pii: science.aau6509. doi: 10.1126/science.aau6509. 10.1126/science.aau6509 PubMed 30385465