eGFP L138 gRNA
(Plasmid
#119133)
-
PurposegRNA that guides Cas9 and APOBEC complexes to L138 in eGFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerJoung Lab
- Backbone size w/o insert (bp) 2278
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP L138 gRNA
-
gRNA/shRNA sequenceccaacatttcagggcacaagc
-
Insert Size (bp)20
-
MutationNone
- Promoter U6
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer CGGTGCCACTTTTTCAAGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP L138 gRNA was a gift from Reuben Harris (Addgene plasmid # 119133 ; http://n2t.net/addgene:119133 ; RRID:Addgene_119133) -
For your References section:
A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582