pColE1_sgRNA_M7NS_AmpR
              
              
                (Plasmid
                
                #119157)
              
            
            
            
          - 
            PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed region
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneYTK095
 - 
              Vector typeCRISPR
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namesgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
 - 
                  Alt namesgRNA-M7NS
 - 
                    gRNA/shRNA sequenceCCATTTTTTGTCAACACGCA
 - Promoter J23119
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site NsiI (not destroyed)
 - 3′ cloning site HindIII (not destroyed)
 - 5′ sequencing primer ttatagtcctgtcgggtttcg (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            A portion of this plasmid was derived from a plasmid made byDr. Chase Beisel Lab
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pColE1_sgRNA_M7NS_AmpR was a gift from Vincent Noireaux (Addgene plasmid # 119157 ; http://n2t.net/addgene:119157 ; RRID:Addgene_119157) - 
                
For your References section:
An educational module to explore CRISPR technologies with a cell-free transcription-translation system. Collias D, Marshall R, Collins SP, Beisel CL, Noireaux V. Synth Biol (Oxf). 2019 Jan 21;4(1):ysz005. doi: 10.1093/synbio/ysz005. eCollection 2019. 10.1093/synbio/ysz005 PubMed 32995532