Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-HyPer3
(Plasmid #119183)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119183 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HyPer3
  • Insert Size (bp)
    1437
  • Promoter CMV
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TTATCTTCCTCCCACAGCTCC
  • 3′ sequencing primer TGGAGTGGCAACTTCCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HyPer3 was originally created by Vsevolod Belousov's laboratory.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Can be used for in vivo expression of the hydrogen peroxide-sensitive fluorescent protein HyPer3. It was used for this purpose in Steinhorn et al. Free Radic Biol Med. 2017 Dec;113:16-25. doi: 10.1016/j.freeradbiomed.2017.09.006.

In the associated publication (Steinhorn et al. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2), it was used as a control for a virus driving expression of a fusion between HyPer and D-amino acid oxidase.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-HyPer3 was a gift from Thomas Michel (Addgene plasmid # 119183 ; http://n2t.net/addgene:119183 ; RRID:Addgene_119183)
  • For your References section:

    Chemogenetic generation of hydrogen peroxide in the heart induces severe cardiac dysfunction. Steinhorn B, Sorrentino A, Badole S, Bogdanova Y, Belousov V, Michel T. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2. 10.1038/s41467-018-06533-2 PubMed 30279532