pAAV-HyPer3
(Plasmid #119183)

• Purpose: AAV expression vector with CMV promoter driving expression of the hydrogen peroxide-sensitive fluorescent biosensor HyPer3.
• Depositing Lab: Thomas Michel
• Publication: Steinhorn et al Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 6000
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HyPer3
• Insert Size (bp): 1437
• Promoter: CMV
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TTATCTTCCTCCCACAGCTCC
• 3′ sequencing primer: TGGAGTGGCAACTTCCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: HyPer3 was originally created by Vsevolod Belousov's laboratory.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Can be used for in vivo expression of the hydrogen peroxide-sensitive fluorescent protein HyPer3. It was used for this purpose in Steinhorn et al. Free Radic Biol Med. 2017 Dec;113:16-25. doi: 10.1016/j.freeradbiomed.2017.09.006.

In the associated publication (Steinhorn et al. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2), it was used as a control for a virus driving expression of a fusion between HyPer and D-amino acid oxidase.