Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-SypHer2-DAAO-NES
(Plasmid #119184)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119184 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SypHer2-DAAO-NES
  • Alt name
    D-amino Acid Oxidase
  • Alt name
    DAAO
  • Species
    R. gracilis
  • Insert Size (bp)
    2571
  • Promoter CMV
  • Tag / Fusion Protein
    • NES (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTGTGCTGGCCCATCACTTT
  • 3′ sequencing primer ACAGGGATGCCACCCGTAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vsevolod Belousov
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

DAAO component of fusion protein received from Vsevolod Belousov, who's lab originally cloned DAAO.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SypHer2-DAAO-NES was a gift from Thomas Michel (Addgene plasmid # 119184 ; http://n2t.net/addgene:119184 ; RRID:Addgene_119184)
  • For your References section:

    Chemogenetic generation of hydrogen peroxide in the heart induces severe cardiac dysfunction. Steinhorn B, Sorrentino A, Badole S, Bogdanova Y, Belousov V, Michel T. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2. 10.1038/s41467-018-06533-2 PubMed 30279532