pAAV-SypHer2-DAAO-NES
(Plasmid
#119184)
-
PurposeFusion of the pH-sensitive fluorescent biosensor SypHer2 with D-amino acid oxidase; excluded from nucleus. CMV promoter. Can serve as a pH control for HyPer.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSypHer2-DAAO-NES
-
Alt nameD-amino Acid Oxidase
-
Alt nameDAAO
-
SpeciesR. gracilis
-
Insert Size (bp)2571
- Promoter CMV
-
Tag
/ Fusion Protein
- NES (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTGTGCTGGCCCATCACTTT
- 3′ sequencing primer ACAGGGATGCCACCCGTAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVsevolod Belousov
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DAAO component of fusion protein received from Vsevolod Belousov, who's lab originally cloned DAAO.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SypHer2-DAAO-NES was a gift from Thomas Michel (Addgene plasmid # 119184 ; http://n2t.net/addgene:119184 ; RRID:Addgene_119184) -
For your References section:
Chemogenetic generation of hydrogen peroxide in the heart induces severe cardiac dysfunction. Steinhorn B, Sorrentino A, Badole S, Bogdanova Y, Belousov V, Michel T. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2. 10.1038/s41467-018-06533-2 PubMed 30279532