Skip to main content

Desmoplakin I no force control (F40-based)
(Plasmid #119187)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119187 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBtet-Pur
  • Backbone manufacturer
    Eric Kowarz
  • Backbone size w/o insert (bp) 5569
  • Total vector size (bp) 13466
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP]
  • Alt name
    Desmoplakin I no force control (F40-based)
  • Alt name
    DPI-ctrl
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7897
  • Mutation
    truncation after aa1945
  • GenBank ID
    NM_004415.3
  • Entrez Gene
    DSP (a.k.a. DCWHKTA, DP)
  • Promoter TCE
  • Tag / Fusion Protein
    • mTFP1-F40-mEYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
  • 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin I and pSBtet-Pur (Addgene plasmid #60507) from Eric Kowarz used as a backbone.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Desmoplakin I no force control (F40-based) was a gift from Alex Dunn (Addgene plasmid # 119187 ; http://n2t.net/addgene:119187 ; RRID:Addgene_119187)
  • For your References section:

    Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252