Desmoplakin I acceptor only control (F40-based tension sensor)
(Plasmid
#119189)
-
PurposeThe acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBtet-Pur
-
Backbone manufacturerEric Kowarz
- Backbone size w/o insert (bp) 5569
- Total vector size (bp) 16228
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945)
-
Alt nameDesmoplakin I acceptor only control (F40-based tension sensor)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)10659
-
Mutationinserted F40-based tension sensor module after aa1945; Y72G in mTFP1 to disrupt chromophore formation
-
GenBank IDNM_004415.3
-
Entrez GeneDSP (a.k.a. DCWHKTA, DP)
- Promoter TCE
-
Tag
/ Fusion Protein
- mTFP1-F40-mEYFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
- 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDesmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin I and pSBtet-Pur (Addgene plasmid #60507) from Eric Kowarz used as a backbone.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Desmoplakin I acceptor only control (F40-based tension sensor) was a gift from Alex Dunn (Addgene plasmid # 119189 ; http://n2t.net/addgene:119189 ; RRID:Addgene_119189) -
For your References section:
Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252