pCas9CR4-VQR
(Plasmid
#120224)
-
PurposepCas9CR4 with VQR mutations for changing PAM site specificity to NGAN or NGNG from Kleinstiver et al. 2015
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepdCas9-bacteria
- Total vector size (bp) 6770
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpCas9-VQR
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)4200
-
MutationMutations D1135V/R1335V/T1337R
- Promoter pTet
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gttgacactctatcgttgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene, Stanley Qi
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The TetR protein coding sequence contains an F178S difference compared to the reference sequence that does not impact the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9CR4-VQR was a gift from Christopher Reisch (Addgene plasmid # 120224 ; http://n2t.net/addgene:120224 ; RRID:Addgene_120224)