Skip to main content
Addgene

Akaluc-N1
(Plasmid #120371)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120371 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3928
  • Total vector size (bp) 5673
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Can be grown at 30°C - just increase incubation time.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Akaluc (human optimized)
  • Insert Size (bp)
    1717
  • Mutation
    Human codon optimized
  • GenBank ID
    LC320664
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The akaluc gene was synthesized with human/murine codon optimization from the protein amino acid sequenced provided by Iwano et. al. Science 2018 as a more sensitive luciferase enzyme for live animal imaging in vivo with the substrate Akalumine-HCl. After synthesis, the gene was cloned and cloned into the eGFP-N1 (Addgene 6085-1) using restriction enzyme cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Akaluc-N1 was a gift from Jordan Green (Addgene plasmid # 120371 ; http://n2t.net/addgene:120371 ; RRID:Addgene_120371)
  • For your References section:

    Photocrosslinked Bioreducible Polymeric Nanoparticles for Enhanced Systemic siRNA Delivery as Cancer Therapy. Karlsson J, Tzeng SY, Hemmati S, Luly KM, Choi O, Rui Y, Wilson DR, Kozielski KL, Quinones-Hinojosa A, Green JJ. Adv Funct Mater. 2021 Apr 22;31(17). doi: 10.1002/adfm.202009768. Epub 2021 Feb 22. 10.1002/adfm.202009768 PubMed 34650390