Akaluc-N1
(Plasmid
#120371)
-
PurposeAkaluc luciferase mammalian expression in -N1 backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120371 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3928
- Total vector size (bp) 5673
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCan be grown at 30°C - just increase incubation time.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAkaluc (human optimized)
-
Insert Size (bp)1717
-
MutationHuman codon optimized
-
GenBank IDLC320664
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The akaluc gene was synthesized with human/murine codon optimization from the protein amino acid sequenced provided by Iwano et. al. Science 2018 as a more sensitive luciferase enzyme for live animal imaging in vivo with the substrate Akalumine-HCl. After synthesis, the gene was cloned and cloned into the eGFP-N1 (Addgene 6085-1) using restriction enzyme cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Akaluc-N1 was a gift from Jordan Green (Addgene plasmid # 120371 ; http://n2t.net/addgene:120371 ; RRID:Addgene_120371) -
For your References section:
Photocrosslinked Bioreducible Polymeric Nanoparticles for Enhanced Systemic siRNA Delivery as Cancer Therapy. Karlsson J, Tzeng SY, Hemmati S, Luly KM, Choi O, Rui Y, Wilson DR, Kozielski KL, Quinones-Hinojosa A, Green JJ. Adv Funct Mater. 2021 Apr 22;31(17). doi: 10.1002/adfm.202009768. Epub 2021 Feb 22. 10.1002/adfm.202009768 PubMed 34650390