Skip to main content

pRRL Luciferase
(Plasmid #120798)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120798 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Luciferase
  • Insert Size (bp)
    1653
  • Promoter hPGK

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAAGCCGCACGTCTCACTAG
  • 3′ sequencing primer CAACTCCTCATAAAGAGACAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL Luciferase was a gift from Paul Khavari (Addgene plasmid # 120798 ; http://n2t.net/addgene:120798 ; RRID:Addgene_120798)
  • For your References section:

    The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242