-
PurposeFor production of lentivirus to express luciferase, primarily for in vivo bioluminescence tracking experiments.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLuciferase
-
Insert Size (bp)1653
- Promoter hPGK
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAAGCCGCACGTCTCACTAG
- 3′ sequencing primer CAACTCCTCATAAAGAGACAGC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL Luciferase was a gift from Paul Khavari (Addgene plasmid # 120798 ; http://n2t.net/addgene:120798 ; RRID:Addgene_120798) -
For your References section:
The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242