-
PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capability
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAGGS vector
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 7021
-
Modifications to backboneone BsaI site was mutated for Golden Gate Assembly purpose
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
-
SpeciesM. musculus (mouse), D. melanogaster (fly), Synthetic
-
Insert Size (bp)2304
-
Mutationlysine 9 is mutated to leucine 9 on histone H3
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCC
- 3′ sequencing primer CAGATGCTCAAGGGGCTTCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K9L mutant of H3K9me3 biosensor was a gift from Yingxiao Wang (Addgene plasmid # 120807 ; http://n2t.net/addgene:120807 ; RRID:Addgene_120807) -
For your References section:
Coordinated histone modifications and chromatin reorganization in a single cell revealed by FRET biosensors. Peng Q, Lu S, Shi Y, Pan Y, Limsakul P, Chernov AV, Qiu J, Chai X, Shi Y, Wang P, Ji Y, Li YJ, Strongin AY, Verkhusha VV, Izpisua Belmonte JC, Ren B, Wang Y, Chien S, Wang Y. Proc Natl Acad Sci U S A. 2018 Nov 26. pii: 1811818115. doi: 10.1073/pnas.1811818115. 10.1073/pnas.1811818115 PubMed 30478057