pJW1583
(Plasmid
#121054)
-
PurposeGFP^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19 (modified)
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 10500
-
Modifications to backboneAddition of ccdB markers to facilitate homology arm cloning
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Turbo
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP^SEC^AID*::3xFlag
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)6850
-
Tags
/ Fusion Proteins
- C. elegans codon optimized GFP
- auxin-inducible degron (AID*)
- 3xFLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is derived from pDD282 (AddGene plasmid 66823)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1583 was a gift from Jordan Ward (Addgene plasmid # 121054 ; http://n2t.net/addgene:121054 ; RRID:Addgene_121054) -
For your References section:
An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541