Skip to main content

pJW1592
(Plasmid #121059)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121059 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19 (modified)
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 10500
  • Modifications to backbone
    Addition of ccdB markers to facilitate homology arm cloning
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Turbo
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP^SEC^BioTag::AID*::3xFlag
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    6850
  • Tags / Fusion Proteins
    • C. elegans codon optimized GFP
    • Biotin acceptor peptide (BioTag)
    • auxin-inducible degron (AID*)
    • 3xFLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is derived from pDD282 (AddGene plasmid 66823)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1592 was a gift from Jordan Ward (Addgene plasmid # 121059 ; http://n2t.net/addgene:121059 ; RRID:Addgene_121059)
  • For your References section:

    An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541