-
PurposeIntegration vector that expresses gfp in S. mutans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMZ
- Total vector size (bp) 7666
-
Modifications to backboneRemoved PaguR promoter / lacZ gene
-
Vector typeS. mutans integration vector, integrates at the mtlA-phnA locus
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor E. coli, grow in Lysogeny broth (LB) containing 50μg/mL kanamycin or 300μg/mL erythromycin. For S. mutans, select with 1000μg/mL kanamycin on agar plates. Other streptococci may require selection on lower amounts of kanamycin (e.g. 500μg/mL).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuperfolder GFP
-
Alt namesfgfp
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDMK301203
- Promoter Pveg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site SphI (unknown if destroyed)
- 5′ sequencing primer mtlA: CAGTCTTAGTCAGGCTTTG
- 3′ sequencing primer phnA: GATTCCATTCATAAGCACAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPM_Pveg-sfgfp was a gift from Robert Shields (Addgene plasmid # 121503 ; http://n2t.net/addgene:121503 ; RRID:Addgene_121503) -
For your References section:
Fluorescence tools adapted for real-time monitoring of the behaviors of Streptococcus species. Shields RC, Kaspar JR, Lee K, Underhill SAM, Burne RA. Appl Environ Microbiol. 2019 May 17. pii: AEM.00620-19. doi: 10.1128/AEM.00620-19. 10.1128/AEM.00620-19 PubMed 31101614