pPM_Pveg-sfgfp
(Plasmid #121503)

• Purpose: Integration vector that expresses gfp in S. mutans
• Depositing Lab: Robert Shields
• Publication: Shields et al Appl Environ Microbiol. 2019 May 17. pii: AEM.00620-19. doi: 10.1128/AEM.00620-19.

Backbone

• Vector backbone: pMZ
• Total vector size (bp): 7666
• Modifications to backbone: Removed PaguR promoter / lacZ gene
• Vector type: S. mutans integration vector, integrates at the mtlA-phnA locus

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For E. coli, grow in Lysogeny broth (LB) containing 50μg/mL kanamycin or 300μg/mL erythromycin. For S. mutans, select with 1000μg/mL kanamycin on agar plates. Other streptococci may require selection on lower amounts of kanamycin (e.g. 500μg/mL).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Superfolder GFP
• Alt name: sfgfp
• Species: Synthetic
• Insert Size (bp): 717
• GenBank ID: MK301203
• Promoter: Pveg

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (unknown if destroyed)
• 3′ cloning site: SphI (unknown if destroyed)
• 5′ sequencing primer: mtlA: CAGTCTTAGTCAGGCTTTG
• 3′ sequencing primer: phnA: GATTCCATTCATAAGCACAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry