Skip to main content
Addgene
Open Menu

pPM_Pveg-sfgfp
(Plasmid #121503)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121503 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 121503-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 121503-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pMZ
  • Total vector size (bp) 7666
  • Modifications to backbone
    Removed PaguR promoter / lacZ gene
  • Vector type
    S. mutans integration vector, integrates at the mtlA-phnA locus

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For E. coli, grow in Lysogeny broth (LB) containing 50μg/mL kanamycin or 300μg/mL erythromycin. For S. mutans, select with 1000μg/mL kanamycin on agar plates. Other streptococci may require selection on lower amounts of kanamycin (e.g. 500μg/mL).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Superfolder GFP
  • Alt name
    sfgfp
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    MK301203
  • Promoter Pveg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site SphI (unknown if destroyed)
  • 5′ sequencing primer mtlA: CAGTCTTAGTCAGGCTTTG
  • 3′ sequencing primer phnA: GATTCCATTCATAAGCACAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPM_Pveg-sfgfp was a gift from Robert Shields (Addgene plasmid # 121503 ; http://n2t.net/addgene:121503 ; RRID:Addgene_121503)

  • For your References section:

    Fluorescence tools adapted for real-time monitoring of the behaviors of Streptococcus species. Shields RC, Kaspar JR, Lee K, Underhill SAM, Burne RA. Appl Environ Microbiol. 2019 May 17. pii: AEM.00620-19. doi: 10.1128/AEM.00620-19. 10.1128/AEM.00620-19 PubMed 31101614
Related items:
Commonly requested with: