Skip to main content

pOTTC1596 - pAAV SYN1 HA-hM3D(Gq)
(Plasmid #121539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121539 Standard format: Plasmid sent in bacteria as agar stab 1 $89
AAV2 121539-AAV2 Limited Stock Available, 1 unit left
Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$437
AAV5 121539-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $437
AAV Retrograde 121539-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $1032

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pOTTC1479 - pAAV SYN1 iRFP-FLAG
  • Backbone manufacturer
    NIDA_GEVVC
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5571
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged hM3D(Gq)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1800
  • GenBank ID
    1131 CHRM3
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
  • Promoter SYN1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
  • 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Information for AAV2 (Catalog # 121539-AAV2) ( Back to top)

Purpose

Ready-to-use AAV2 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA.

Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene HA

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 121539-AAV5) ( Back to top)

Purpose

Ready-to-use AAV5 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA.

Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene HA

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 121539-AAVrg) ( Back to top)

Purpose

Ready-to-use AAV Retrograde particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA.

Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $1000 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) was a gift from Christopher Richie (Addgene plasmid # 121539 ; http://n2t.net/addgene:121539 ; RRID:Addgene_121539) For viral preps, please replace (Addgene plasmid # 121539) in the above sentence with: (Addgene viral prep # 121539-AAV2), (Addgene viral prep # 121539-AAV5), or (Addgene viral prep # 121539-AAVrg)
  • For your References section:

    Ultrastructural localization of DREADDs in monkeys. Galvan A, Raper J, Hu X, Pare JF, Bonaventura J, Richie CT, Michaelides M, Mueller SAL, Roseboom PH, Oler JA, Kalin NH, Hall RA, Smith Y. Eur J Neurosci. 2019 May 7. doi: 10.1111/ejn.14429. 10.1111/ejn.14429 PubMed 31063250