Skip to main content

pUC19-U6-AasgRNA3.8.3
(Plasmid #121959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121959 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19, BsaI site mutated
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AaCas12b single chimeric gRNA, MS2 hairpin inserted
  • Alt name
    AaC2c1 single chimeric gRNA, MS2 hairpin inserted
  • gRNA/shRNA sequence
    GTCTAAAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAACTTCGGCCAACATGAGGATCACCCATGTCTGCAGGGCCGAAGTGGCAC
  • Species
    Synthetic

Cloning Information

  • Cloning method Ligation Independent Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-U6-AasgRNA3.8.3 was a gift from Wei Li (Addgene plasmid # 121959 ; http://n2t.net/addgene:121959 ; RRID:Addgene_121959)
  • For your References section:

    Repurposing CRISPR-Cas12b for mammalian genome engineering. Teng F, Cui T, Feng G, Guo L, Xu K, Gao Q, Li T, Li J, Zhou Q, Li W. Cell Discov. 2018 Nov 27;4:63. doi: 10.1038/s41421-018-0069-3. eCollection 2018. 10.1038/s41421-018-0069-3 PubMed 30510770