Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLp_3050sNuc
(Plasmid #122030)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122030 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    spp-based expression vector (pSIP401)
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6188
  • Vector type
    Bacterial Expression
  • Selectable markers
    Erythromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    signal peptide Lp_3050
  • Species
    Signal peptide from Lp_3050 gene in Lactobacillus plantarum
  • Insert Size (bp)
    124
  • Promoter sppA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer GGCTTTTATAATATGAGATAATGCCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid for heterologous secretion of proteins in Lactobacillus plantarum and L. sakei

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLp_3050sNuc was a gift from Vincent Eijsink & Geir Mathiesen (Addgene plasmid # 122030 ; http://n2t.net/addgene:122030 ; RRID:Addgene_122030)
  • For your References section:

    Genome-wide analysis of signal peptide functionality in Lactobacillus plantarum WCFS1. Mathiesen G, Sveen A, Brurberg MB, Fredriksen L, Axelsson L, Eijsink VG. BMC Genomics. 2009 Sep 10;10:425. doi: 10.1186/1471-2164-10-425. 10.1186/1471-2164-10-425 PubMed 19744343